Stem-loop sequence osa-MIR166e

AccessionMI0000674 (change log)
DescriptionOryza sativa miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

69 open access papers mention osa-MIR166e
(284 sentences)

Stem-loop
             u      uu         a  gc   uu     g  u   uuuu    guuua      ca 
5' uguuucuggg ggaaug  gucugguuc ag  ccc  aggau ug gau    gaug     ugcauu  u
   |||||||||| ||||||  ||||||||| ||  |||  ||||| || |||    ||||     ||||||   
3' auagagacuc ccuuac  cggaccaag uc  ggg  uucua gc cua    cuac     gcguag  c
             c      uu         c  uu   -u     g  u   ---u    ---aa      uu 
Get sequence
Deep sequencing
29064 reads, 1.98e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 765724-765860 [+]
intergenic
Database links

Mature sequence osa-miR166e-5p

Accession MIMAT0022859
Sequence

12 - 

ggaauguugucugguucaagg

 - 32

Get sequence
Deep sequencing179 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166e-3p

Accession MIMAT0000639
Previous IDsosa-miR166e
Sequence

108 - 

ucgaaccaggcuucauucccc

 - 128

Get sequence
Deep sequencing28885 reads, 2 experiments
Evidence by similarity; MI0000202
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).