Stem-loop sequence osa-MIR166d

AccessionMI0000673 (change log)
DescriptionOryza sativa miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

73 open access papers mention osa-MIR166d
(264 sentences)

Stem-loop
   ga      uuc    u          uu      cu      g  uggagaaaccucugaucga 
5'   agcuuu   acuu gaggggaaug  gucugg  cgaggu ca                   u
     ||||||   |||| ||||||||||  ||||||  |||||| ||                    
3'   ucgaaa   ugaa cuccccuuac  cggacc  gcucua gu                   c
   cc      ---    -          uu      ag      -  cagagaugucuaguuugga 
Get sequence
Deep sequencing
37141 reads, 2.44e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 26130059-26130183 [+]
intergenic
Database links

Mature sequence osa-miR166d-5p

Accession MIMAT0022858
Sequence

21 - 

ggaauguugucuggcucgagg

 - 41

Get sequence
Deep sequencing230 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166d-3p

Accession MIMAT0000638
Previous IDsosa-miR166d
Sequence

91 - 

ucggaccaggcuucauucccc

 - 111

Get sequence
Deep sequencing36909 reads, 2 experiments
Evidence by similarity; MI0000207
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).