Stem-loop sequence osa-MIR166c

AccessionMI0000672 (change log)
DescriptionOryza sativa miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

72 open access papers mention osa-MIR166c
(268 sentences)

Stem-loop
   g        -----        uu                aa    g   ggaauggcggauuc 
5'  gcaguuga     ggggaaug  gucugguccgagaccu  cacc ggc              a
    ||||||||     ||||||||  ||||||||||||||||  |||| |||               
3'  ugucaacu     ccccuuac  cggaccaggcuuuggg  gugg ucg              g
   u        caacc        uu                gg    a   aacgaaucgacguc 
Get sequence
Deep sequencing
36567 reads, 2.4e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 3487788-3487912 [+]
intergenic
Database links

Mature sequence osa-miR166c-5p

Accession MIMAT0022857
Sequence

12 - 

ggaauguugucugguccgag

 - 31

Get sequence
Deep sequencing117 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166c-3p

Accession MIMAT0000637
Previous IDsosa-miR166c
Sequence

91 - 

ucggaccaggcuucauucccc

 - 111

Get sequence
Deep sequencing36449 reads, 2 experiments
Evidence by similarity; MI0000204
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).