Stem-loop sequence osa-MIR166b

AccessionMI0000671 (change log)
DescriptionOryza sativa miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

73 open access papers mention osa-MIR166b
(265 sentences)

Stem-loop
              cau    a        uu      cu     -    uuuua    -     -      -   --     cu     --c    uccuagcuu    u 
5' gggagccuuuu   uuug ggggaaug  gucugg  cgggg cuac     auuu cucuc ucuuuu gau  aucuu  uuucu   gauc         gauc u
   |||||||||||   |||| ||||||||  ||||||  ||||| ||||     |||| ||||| |||||| |||  |||||  |||||   ||||         ||||  
3' cccucgggaag   aaac ccccuuac  cggacc  gcucu gaug     uaga gagag agagaa cug  uagaa  aaaga   cuag         cuag u
              -ac    c        uu      ag     a    -ucug    u     u      a   ac     --     auu    cuaaacucu    u 
Get sequence
Deep sequencing
37136 reads, 2.44e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 30327084-30327289 [-]
intergenic
Database links

Mature sequence osa-miR166b-5p

Accession MIMAT0022856
Sequence

22 - 

ggaauguugucuggcucgggg

 - 42

Get sequence
Deep sequencing228 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166b-3p

Accession MIMAT0000636
Previous IDsosa-miR166b
Sequence

168 - 

ucggaccaggcuucauucccc

 - 188

Get sequence
Deep sequencing36908 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).