Stem-loop sequence osa-MIR166a

AccessionMI0000670 (change log)
DescriptionOryza sativa miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

75 open access papers mention osa-MIR166a
(295 sentences)

Stem-loop
   u         ugcu      u      uu         a          caccuugcgguuuugaggaugauu 
5'  gaagcuauu    ucugag ggaaug  gucugguuc aggucucaug                        u
    |||||||||    |||||| ||||||  ||||||||| ||||||||||                        g
3'  cuucgauag    agacuc ccuuac  cggaccagg ucuagggugc                        u
   a         ----      c      uu         c          cuacucuccuuacuuuuuggaacg 
Get sequence
Deep sequencing
37104 reads, 2.43e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 19987135-19987279 [+]
intergenic
Database links

Mature sequence osa-miR166a-5p

Accession MIMAT0022855
Sequence

22 - 

ggaauguugucugguucaagg

 - 42

Get sequence
Deep sequencing191 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166a-3p

Accession MIMAT0000635
Previous IDsosa-miR166a
Sequence

110 - 

ucggaccaggcuucauucccc

 - 130

Get sequence
Deep sequencing36909 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).