Stem-loop sequence osa-MIR164b

AccessionMI0000669 (change log)
DescriptionOryza sativa miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

67 open access papers mention osa-MIR164b
(287 sentences)

Stem-loop
       a           ca         cauu        cuc  -c  c       
5' gugc cgguggagaag  gggcacgug    accaucca   gc  ug cggccg 
   |||| |||||||||||  |||||||||    ||||||||   ||  || ||||| c
3' cacg gccaccucuuc  cccguguac    ugguaggu   cg  ac gccggc 
       a           ug         uucu        -ac  uu  c       
Get sequence
Deep sequencing
3068 reads, 1.9e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 15896163-15896271 [-]
intergenic
Database links

Mature sequence osa-miR164b

Accession MIMAT0000634
Sequence

9 - 

uggagaagcagggcacgugca

 - 29

Get sequence
Deep sequencing3038 reads, 2 experiments
Evidence by similarity; MI0000197
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).