Stem-loop sequence osa-MIR164a

AccessionMI0000668 (change log)
DescriptionOryza sativa miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

73 open access papers mention osa-MIR164a
(302 sentences)

Stem-loop
          --      c u        c   g        -   auau    aucauc    --u     -u  uc u -ua  u 
5' gugagaa  ggaccg g uggagaag agg cacgugca ugc    guuc      aucu   cuucc  cc  c c   gc c
   |||||||  |||||| | |||||||| ||| |||||||| |||    ||||      ||||   |||||  ||  | |   ||  
3' cacucuu  ucuggc c accucuuc ucu gugcacgu acg    caag      uaga   gaagg  gg  g g   cg c
          uu      c u        c   g        c   --cu    -----a    uuu     uu  gu u uuc  a 
Get sequence
Deep sequencing
3027 reads, 1.9e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 28523341-28523496 [-]
intergenic
Database links

Mature sequence osa-miR164a

Accession MIMAT0000633
Sequence

17 - 

uggagaagcagggcacgugca

 - 37

Get sequence
Deep sequencing3026 reads, 2 experiments
Evidence by similarity; MI0000197
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).