Stem-loop sequence osa-MIR162a

AccessionMI0000667 (change log)
Previous IDsosa-MIR162
DescriptionOryza sativa miR162a stem-loop
Gene family MIPF0000169; MIR162_2
Literature search

29 open access papers mention osa-MIR162a
(50 sentences)

Stem-loop
        ugc    gc    u            cc     u  c    ----   gcugauccaggagcggcgaauuucuuugagaggg 
5' gguga   cugg  gcag gguuuaucgauc  uuccc gc uugu    ggc                                  u
   |||||   ||||  |||| ||||||||||||  ||||| || ||||    |||                                   
3' ccgcu   gacc  cguc ccaaauagcuag  aaggg cg aaca    ccg                                  g
        cuu    ua    u            cu     -  c    gcaa   acguuguuccugguuuuccuucuuuuuuuuucuu 
Get sequence
Deep sequencing
670 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 23605799-23605969 [+]
intergenic
Database links

Mature sequence osa-miR162a

Accession MIMAT0000632
Sequence

143 - 

ucgauaaaccucugcauccag

 - 163

Get sequence
Deep sequencing667 reads, 2 experiments
Evidence by similarity; MI0000194
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).