Stem-loop sequence osa-MIR160d

AccessionMI0000666 (change log)
DescriptionOryza sativa miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

57 open access papers mention osa-MIR160d
(184 sentences)

Stem-loop
   gg  a     c       c         cu   -    cu       ucagu    -    c     ---    c 
5'   gg uaugc uggcucc uguaugcca  cgc guag  gccaaac     ugaa acaa ugccu   ucuc c
     || ||||| ||||||| |||||||||  ||| ||||  |||||||     |||| |||| |||||   |||| g
3'   cc guacg accgagg gcgugcggu  gcg cauc  cgguuug     gcuu uguu acgga   agag g
   --  a     a       a         ag   u    -u       --cau    g    -     cuu    c 
Get sequence
Deep sequencing
685 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 32454988-32455129 [+]
intergenic
Database links

Mature sequence osa-miR160d-5p

Accession MIMAT0000631
Previous IDsosa-miR160d
Sequence

8 - 

ugccuggcucccuguaugcca

 - 28

Get sequence
Deep sequencing519 reads, 2 experiments
Evidence by similarity; MI0000190
Database links

Mature sequence osa-miR160d-3p

Accession MIMAT0022854
Sequence

119 - 

gcgugcgaggagccaagcaug

 - 139

Get sequence
Deep sequencing166 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).