Stem-loop sequence osa-MIR160c

AccessionMI0000665 (change log)
DescriptionOryza sativa miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

57 open access papers mention osa-MIR160c
(182 sentences)

Stem-loop
            c       c         cu    -   a     aaa   c 
5' ggaaugugc uggcucc uguaugcca  cauc uag gcaac   cuu u
   ||||||||| ||||||| |||||||||  |||| ||| |||||   |||  
3' ccuuauacg accgagg acgugcggu  guag auc cguug   gag g
            a       c         ag    u   -     -ga   c 
Get sequence
Deep sequencing
730 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 1707568-1707666 [+]
intergenic
Database links

Mature sequence osa-miR160c-5p

Accession MIMAT0000630
Previous IDsosa-miR160c
Sequence

7 - 

ugccuggcucccuguaugcca

 - 27

Get sequence
Deep sequencing521 reads, 2 experiments
Evidence by similarity; MI0000190
Database links

Mature sequence osa-miR160c-3p

Accession MIMAT0022853
Sequence

75 - 

gcgugcacggagccaagcaua

 - 95

Get sequence
Deep sequencing201 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).