Stem-loop sequence osa-MIR160b

AccessionMI0000664 (change log)
DescriptionOryza sativa miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

57 open access papers mention osa-MIR160b
(186 sentences)

Stem-loop
        --uu  uuuu    --   uugaga      c       c              gu   cca     ugg 
5' aaggu    gg    gauc  ggc      gcgugc uggcucc uguaugccacucau  agc   aucca   u
   |||||    ||    ||||  |||      |||||| ||||||| ||||||||||||||  |||   |||||   g
3' uuccg    uc    cuag  ccg      cguacg accgagg acgugcggugggug  ucg   uaggu   u
        ucuu  -ucu    ua   ----ug      a       a              --   ---     uug 
Get sequence
Deep sequencing
734 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 28081020-28081158 [+]
intergenic
Database links

Mature sequence osa-miR160b-5p

Accession MIMAT0000629
Previous IDsosa-miR160b
Sequence

30 - 

ugccuggcucccuguaugcca

 - 50

Get sequence
Deep sequencing519 reads, 2 experiments
Evidence by similarity; MI0000192
Database links

Mature sequence osa-miR160b-3p

Accession MIMAT0022852
Sequence

93 - 

gcgugcaaggagccaagcaug

 - 113

Get sequence
Deep sequencing215 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).