Stem-loop sequence osa-MIR160a

AccessionMI0000663 (change log)
DescriptionOryza sativa miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

63 open access papers mention osa-MIR160a
(199 sentences)

Stem-loop
         c       c          a  u    ac     caug 
5' gugugc uggcucc uguaugccac ca guag  caacc    g
   |||||| ||||||| |||||||||| || ||||  |||||     
3' cguacg accgagg acgugcggug gu cauc  guugg    u
         a       a          g  -    -c     ucug 
Get sequence
Deep sequencing
734 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 3511585-3511672 [-]
intergenic
Database links

Mature sequence osa-miR160a-5p

Accession MIMAT0000628
Previous IDsosa-miR160a
Sequence

4 - 

ugccuggcucccuguaugcca

 - 24

Get sequence
Deep sequencing519 reads, 2 experiments
Evidence by similarity; MI0000192
Database links

Mature sequence osa-miR160a-3p

Accession MIMAT0022851
Sequence

67 - 

gcgugcaaggagccaagcaug

 - 87

Get sequence
Deep sequencing215 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).