Stem-loop sequence osa-MIR156j

AccessionMI0000662
DescriptionOryza sativa miR156j stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
             ----      uc   cau    aaggc     u          -   -         a     c  c   u  c    g 
5' uuggggcggg    gcggga  gag   auga     gagau guugacagaa gag agugagcac cggcg gg ggc ag cauc g
   ||||||||||    ||||||  |||   ||||     ||||| |||||||||| ||| ||||||||| ||||| || ||| || |||| c
3' agccccgccc    cgcccu  cuc   uacu     cucua cgacugucuu cuc ucgcucgug gccgc cc ccg uc guag g
             ccua      cc   -ac    -----     -          u   c         c     -  -   -  c    g 
Get sequence
Deep sequencing
21442588 reads, 2.77e+05 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 26554795-26554959 [+]
intergenic

Mature sequence osa-miR156j-5p

Accession MIMAT0000627
Previous IDsosa-miR156j
Sequence

42 - 

ugacagaagagagugagcac

 - 61

Get sequence
Deep sequencing19871949 reads, 68 experiments
Evidence by similarity; MI0000179

Mature sequence osa-miR156j-3p

Accession MIMAT0022850
Sequence

108 - 

gcucgcuccucuuucugucagc

 - 129

Get sequence
Deep sequencing545 reads, 40 experiments
Evidence experimental; Illumina [2]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).