Stem-loop sequence osa-MIR156h

AccessionMI0000660 (change log)
DescriptionOryza sativa miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

120 open access papers mention osa-MIR156h
(651 sentences)

Stem-loop
              -    -        a       c  a   caucgaucuaucaaucuucccuucgacaggauagcuagauagaaagaaagagag 
5' aguugacagaa gaga gugagcac cagcggc ag cug                                                      g
   ||||||||||| |||| |||||||| ||||||| || |||                                                       
3' ucgacugucuu cucu cacucgug gucgccg uc gac                                                      c
              u    u        c       -  -   auaguaguaguaguaaaguagagagagagagagagagaagguaccggcggcugc 
Get sequence
Deep sequencing
568814 reads, 3.91e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 21491232-21491417 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR156h
osa-MIR5157bChr8: 21489165-21489257 [-]
osa-MIR156hChr8: 21491232-21491417 [+]
Database links

Mature sequence osa-miR156h-5p

Accession MIMAT0031156
Sequence

4 - 

ugacagaagagagugagcac

 - 23

Get sequence
Deep sequencing568662 reads, 2 experiments
Evidence by similarity; MI0000178
Database links

Mature sequence osa-miR156h-3p

Accession MIMAT0031157
Sequence

164 - 

gcucacuucucuuucugucagc

 - 185

Get sequence
Deep sequencing118 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).