Stem-loop sequence osa-MIR156h

AccessionMI0000660 (change log)
DescriptionOryza sativa miR156h stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
              -    -        a       c  a   caucgaucuaucaaucuucccuucgacaggauagcuagauagaaagaaagagag 
5' aguugacagaa gaga gugagcac cagcggc ag cug                                                      g
   ||||||||||| |||| |||||||| ||||||| || |||                                                       
3' ucgacugucuu cucu cacucgug gucgccg uc gac                                                      c
              u    u        c       -  -   auaguaguaguaguaaaguagagagagagagagagagaagguaccggcggcugc 
Get sequence
Deep sequencing
568814 reads, 3.91e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 21491232-21491417 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR156h
osa-MIR5157bChr8: 21489165-21489257 [-]
osa-MIR156hChr8: 21491232-21491417 [+]
Database links

Mature sequence osa-miR156h-5p

Accession MIMAT0031156
Sequence

4 - 

ugacagaagagagugagcac

 - 23

Get sequence
Deep sequencing568662 reads, 2 experiments
Evidence by similarity; MI0000178
Database links

Mature sequence osa-miR156h-3p

Accession MIMAT0031157
Sequence

164 - 

gcucacuucucuuucugucagc

 - 185

Get sequence
Deep sequencing118 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).