Stem-loop sequence osa-MIR156f

AccessionMI0000658 (change log)
DescriptionOryza sativa miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

119 open access papers mention osa-MIR156f
(649 sentences)

              -    -        a       c  a   caucgaucuaucaaucuucccuucgacaggauagcuagauagaaagaaagagag 
5' aguugacagaa gaga gugagcac cagcggc ag cug                                                      g
   ||||||||||| |||| |||||||| ||||||| || |||                                                       
3' ucgacugucuu cucu cacucgug gucgccg uc gac                                                      c
              u    u        c       -  -   auaguaguaguaguaaaguagagagagagagagagagaagguaccggcggcugc 
Get sequence
Deep sequencing
568814 reads, 3.91e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 21478230-21478415 [+]
Clustered miRNAs
< 10kb from osa-MIR156f
osa-MIR5157aChr8: 21476163-21476255 [-]
osa-MIR156fChr8: 21478230-21478415 [+]
Database links

Mature sequence osa-miR156f-5p

Accession MIMAT0000623
Previous IDsosa-miR156f

4 - 


 - 23

Get sequence
Deep sequencing568662 reads, 2 experiments
Evidence by similarity; MI0000178
Database links

Mature sequence osa-miR156f-3p

Accession MIMAT0022847

164 - 


 - 185

Get sequence
Deep sequencing118 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links


PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).