Stem-loop sequence osa-MIR156d

AccessionMI0000656 (change log)
DescriptionOryza sativa miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

120 open access papers mention osa-MIR156d
(699 sentences)

Stem-loop
       --a      cau    ------u        -   -         a     ugau  c   c   a 
5' ggag   agcucu   gaga       ugacagaa gag agugagcac cggcg    gg cgg aua a
   ||||   ||||||   ||||       |||||||| ||| ||||||||| |||||    || ||| ||| a
3' ccuc   ucggga   cucu       acugucuu cuc ucacucgug gccgc    cc gcc uau u
       aac      -cu    uucuccc        u   c         c     ---u  u   c   c 
Get sequence
Deep sequencing
568804 reads, 3.91e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 4512884-4513012 [-]
intergenic
Database links

Mature sequence osa-miR156d

Accession MIMAT0000621
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Deep sequencing568666 reads, 2 experiments
Evidence by similarity; MI0000183
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).