Stem-loop sequence osa-MIR156d

Accession

MI0000656

Description

Oryza sativa miR156d stem-loop

Gene family

MIPF0000008; MIR156

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Stem-loop

    --a      cau    ------u        -   -         a     ugau  c   c   a 
ggag   agcucu   gaga       ugacagaa gag agugagcac cggcg    gg cgg aua a
||||   ||||||   ||||       |||||||| ||| ||||||||| |||||    || ||| ||| a
ccuc   ucggga   cucu       acugucuu cuc ucacucgug gccgc    cc gcc uau u
    aac      -cu    uucuccc        u   c         c     ---u  u   c   c 

Deep sequencing

25785 reads, 4 experiments

Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context

• Coordinates (MSU7): Chr2: 4512884-4513012 [-]
• Overlapping transcripts:

  intergenic

Mature sequence osa-miR156d

• Accession: MIMAT0000621
• Sequence: 20 - ugacagaagagagugagcac - 39
• Deep sequencing: 25178 reads, 4 experiments
• Evidence: by similarity; MI0000183

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).