Stem-loop sequence osa-MIR156c

AccessionMI0000655 (change log)
DescriptionOryza sativa miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

120 open access papers mention osa-MIR156c
(651 sentences)

Stem-loop
               gg u       g ---          -     -               gacu   uu     cu aa 
5' ggaggaagagag  g gagaggu a   ggcugacaga agaga gugagcacacauggu    uuc  gcaug  g  u
   ||||||||||||  | ||||||| |   |||||||||| ||||| |||||||||||||||    |||  |||||  |   
3' ccucuuucucuc  u cucucua u   ccgacugucu ucucu cacucguguguaucg    aag  cguac  c  g
               uu -       g uua          c     u               ----   uu     -u ag 
Get sequence
Deep sequencing
560173 reads, 3.86e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 4665975-4666123 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR156c
osa-MIR156cChr1: 4665975-4666123 [+]
osa-MIR156bChr1: 4666341-4666516 [+]
Database links

Mature sequence osa-miR156c-5p

Accession MIMAT0000620
Previous IDsosa-miR156c
Sequence

29 - 

ugacagaagagagugagcac

 - 48

Get sequence
Deep sequencing560121 reads, 2 experiments
Evidence by similarity; MI0000183
Database links

Mature sequence osa-miR156c-3p

Accession MIMAT0022846
Sequence

100 - 

gcucacuucucucucugucagc

 - 121

Get sequence
Deep sequencing51 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).