Stem-loop sequence osa-MIR156b

AccessionMI0000654 (change log)
DescriptionOryza sativa miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

120 open access papers mention osa-MIR156b
(662 sentences)

Stem-loop
   u    --          a   --    ucua     uu   ----a  u        -             a      gcuu          - a 
5'  uguc  uugagagggg aga  gauc    ugggu  ugg     gg cugacaga agagagugagcac cacggu    ucuuagcaug c a
    ||||  |||||||||| |||  ||||    |||||  |||     || |||||||| ||||||||||||| ||||||    |||||||||| |  
3'  acag  gacucucuuc ucu  uuag    acccg  acc     cc gacugucu ucucucacucgug gugucg    agggucguac g g
   g    uu          c   aa    uaua     -u   acuug  -        a             c      ----          c a 
Get sequence
Deep sequencing
560484 reads, 3.86e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 4666341-4666516 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR156b
osa-MIR156cChr1: 4665975-4666123 [+]
osa-MIR156bChr1: 4666341-4666516 [+]
Database links

Mature sequence osa-miR156b-5p

Accession MIMAT0000619
Previous IDsosa-miR156b
Sequence

43 - 

ugacagaagagagugagcac

 - 62

Get sequence
Deep sequencing560429 reads, 2 experiments
Evidence by similarity; MI0000183
Database links

Mature sequence osa-miR156b-3p

Accession MIMAT0022845
Sequence

110 - 

gcucacucucuaucugucagc

 - 130

Get sequence
Deep sequencing54 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).