Stem-loop sequence osa-MIR156a

AccessionMI0000653 (change log)
DescriptionOryza sativa miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

122 open access papers mention osa-MIR156a
(688 sentences)

Stem-loop
        g       -     -        a      uguu   uu     aau 
5' ggagg ugacaga agaga gugagcac cguggu    ucc  gcaua   g
   ||||| ||||||| ||||| |||||||| ||||||    |||  |||||   a
3' ccucc acugucu ucucu cacucgug gcaucg    agg  cguau   u
        -       c     u        c      ----   uu     ccg 
Get sequence
Deep sequencing
560111 reads, 3.86e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 22524147-22524246 [-]
intergenic
Database links

Mature sequence osa-miR156a

Accession MIMAT0000618
Sequence

7 - 

ugacagaagagagugagcac

 - 26

Get sequence
Deep sequencing560060 reads, 2 experiments
Evidence by similarity; MI0000183
Database links

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).