Stem-loop sequence mmu-mir-1a-2

AccessionMI0000652 (change log)
Previous IDsmmu-mir-1b;mmu-mir-1-2
Symbol MGI:Mir1a-2
DescriptionMus musculus miR-1a-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

287 open access papers mention mmu-mir-1a-2
(2926 sentences)

Stem-loop
   u     c                ac     uga  a 
5'  cagag acauacuucuuuaugu  ccaua   ac u
    ||||| ||||||||||||||||  |||||   || u
3'  guuuu uguaugaagaaaugua  gguau   ug c
   -     a                -a     -cg  a 
Get sequence
Deep sequencing
26186460 reads, 1.76e+04 reads per million, 100 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MI0000651, mouse MI0000139), and mir-1-2 (human MI0000437, mouse MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 10785481-10785552 [-]
sense
OTTMUST00000111849 ; RP24-66N1.1-001; intron 1
ENSMUST00000179771 ; Gm21747-001; intron 1
antisense
OTTMUST00000070818 ; Mib1-004; intron 5
OTTMUST00000070815 ; Mib1-001; intron 12
ENSMUST00000117012 ; Mir1b-201; exon 1
ENSMUST00000124288 ; Mib1-004; intron 5
ENSMUST00000052838 ; Mib1-001; intron 12
ENSMUST00000165555 ; Mib1-201; intron 13
Clustered miRNAs
< 10kb from mmu-mir-1a-2
mmu-mir-1a-2chr18: 10785481-10785552 [-]
mmu-mir-1bchr18: 10785446-10785567 [+]
mmu-mir-133a-1chr18: 10782909-10782976 [-]
Database links

Mature sequence mmu-miR-1a-2-5p

Accession MIMAT0017047
Previous IDsmmu-miR-1-2*;mmu-miR-1a-2*
Sequence

8 - 

acauacuucuuuauguacccaua

 - 30

Get sequence
Deep sequencing224 reads, 12 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-1a-3p

Accession MIMAT0000123
Previous IDsmmu-miR-1;mmu-miR-1a
Sequence

47 - 

uggaauguaaagaaguauguau

 - 68

Get sequence
Deep sequencing52372476 reads, 100 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).