Stem-loop sequence hsa-mir-200c

Accession MI0000650
Symbol HGNC:MIR200C
Description Homo sapiens miR-200c stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  cu    -      a        u   u  ggu 
cc  cguc uuaccc gcaguguu ggg gc   u
||  |||| |||||| |||||||| ||| ||    
gg  guag aauggg cgucauaa cuc ug   g
  ag    u      c        u   -  agg 
Get sequence
Deep sequencing
6488 reads, 43 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 7072862-7072929 [+]
sense
OTTHUMT00000402989 ; U47924.27-001; intron 1
OTTHUMT00000402989 ; U47924.27-001; intron 1
OTTHUMT00000402989 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-200c
hsa-mir-200c chr12: 7072862-7072929 [+]
hsa-mir-141 chr12: 7073260-7073354 [+]
Database links

Mature sequence hsa-miR-200c-5p

Accession MIMAT0004657
Previous IDs hsa-miR-200c*
Sequence

5 - 

cgucuuacccagcaguguuugg

 - 26

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-200c-3p

Accession MIMAT0000617
Previous IDs hsa-miR-200c
Sequence

44 - 

uaauacugccggguaaugaugga

 - 66

Get sequence
Deep sequencing 6483 reads, 42 experiments
Evidence experimental; cloned [1-4], Northern [2]
Validated targets
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).