Stem-loop sequence hsa-mir-200c

AccessionMI0000650 (change log)
Symbol HGNC:MIR200C
DescriptionHomo sapiens miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

729 open access papers mention hsa-mir-200c
(4768 sentences)

Stem-loop
     cu    -      a        u   u  ggu 
5' cc  cguc uuaccc gcaguguu ggg gc   u
   ||  |||| |||||| |||||||| ||| ||    
3' gg  guag aauggg cgucauaa cuc ug   g
     ag    u      c        u   -  agg 
Get sequence
Deep sequencing
2055532 reads, 4.88e+03 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 6963699-6963766 [+]
sense
OTTHUMT00000402982 ; USP5-001; intron 1
OTTHUMT00000402983 ; USP5-002; intron 1
OTTHUMT00000402984 ; USP5-003; intron 1
ENST00000229268 ; USP5-001; intron 1
ENST00000389231 ; USP5-002; intron 1
ENST00000542087 ; USP5-003; intron 1
Clustered miRNAs
< 10kb from hsa-mir-200c
hsa-mir-200cchr12: 6963699-6963766 [+]
hsa-mir-141chr12: 6964097-6964191 [+]
Database links

Mature sequence hsa-miR-200c-5p

Accession MIMAT0004657
Previous IDshsa-miR-200c*
Sequence

5 - 

cgucuuacccagcaguguuugg

 - 26

Get sequence
Deep sequencing2360 reads, 79 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-200c-3p

Accession MIMAT0000617
Previous IDshsa-miR-200c
Sequence

44 - 

uaauacugccggguaaugaugga

 - 66

Get sequence
Deep sequencing2053151 reads, 158 experiments
Evidence experimental; cloned [1-4], Northern [2]
Database links
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).