Stem-loop sequence mmu-mir-101b

AccessionMI0000649 (change log)
Symbol MGI:Mir101b
DescriptionMus musculus miR-101b stem-loop
Gene family MIPF0000046; mir-101
Literature search

114 open access papers mention mmu-mir-101b
(820 sentences)

Stem-loop
   aucugagac  -a      c                  accgau      g  c 
5'          ug  acugcc uuuuucgguuaucauggu      gcugua cu u
            ||  |||||| ||||||||||||||||||      |||||| || g
3'          ac  uggcgg aagaagucgauaguguca      ugacau ga a
   -------cu  cg      u                  ------      g  a 
Get sequence
Deep sequencing
2397819 reads, 3.29e+03 reads per million, 125 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 29135279-29135375 [+]
sense
ENSMUST00000064393 ; Rcl1-201; intron 8
Database links

Mature sequence mmu-miR-101b-5p

Accession MIMAT0017046
Previous IDsmmu-miR-101b*
Sequence

24 - 

ucgguuaucaugguaccgaugcu

 - 46

Get sequence
Deep sequencing56 reads, 31 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-101b-3p

Accession MIMAT0000616
Previous IDsmmu-miR-101b
Sequence

60 - 

guacaguacugugauagcu

 - 78

Get sequence
Deep sequencing2397696 reads, 126 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).