Stem-loop sequence rno-mir-101b

AccessionMI0000648 (change log)
DescriptionRattus norvegicus miR-101b stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aucugagac  -a  ug  c                    c a    --g  g 
5'          ug  ac  uc uuuuucgguuaucaugguac g ugcu   ua a
            ||  ||  || |||||||||||||||||||| | ||||   ||  
3'          ac  ug  gg aagaagucgauagugucaug c augg   gu u
   -------cu  cg  gu  u                    a -    aaa  c 
Get sequence
Deep sequencing
262647 reads, 2.29e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 247263723-247263819 [+]
sense
ENSRNOT00000020809 ; Rcl1-202; intron 4
ENSRNOT00000048910 ; Rcl1-201; intron 9
Database links

Mature sequence rno-miR-101b-5p

Accession MIMAT0017045
Previous IDsrno-miR-101b*
Sequence

24 - 

ucgguuaucaugguaccgaugc

 - 45

Get sequence
Deep sequencing21 reads, 9 experiments
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-101b-3p

Accession MIMAT0000615
Previous IDsrno-miR-101b
Sequence

61 - 

uacaguacugugauagcugaa

 - 81

Get sequence
Deep sequencing262616 reads, 39 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).