Stem-loop sequence rno-mir-101b

AccessionMI0000648 (change log)
DescriptionRattus norvegicus miR-101b stem-loop
Gene family MIPF0000046; mir-101
Literature search

22 open access papers mention rno-mir-101b
(174 sentences)

Stem-loop
   aucugagac  -a  ug  c                    c a    --g  g 
5'          ug  ac  uc uuuuucgguuaucaugguac g ugcu   ua a
            ||  ||  || |||||||||||||||||||| | ||||   ||  
3'          ac  ug  gg aagaagucgauagugucaug c augg   gu u
   -------cu  cg  gu  u                    a -    aaa  c 
Get sequence
Deep sequencing
3359623 reads, 2.77e+03 reads per million, 513 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 247263723-247263819 [+]
sense
ENSRNOT00000020809 ; Rcl1-202; intron 4
ENSRNOT00000048910 ; Rcl1-201; intron 9
Database links

Mature sequence rno-miR-101b-5p

Accession MIMAT0017045
Previous IDsrno-miR-101b*
Sequence

24 - 

ucgguuaucaugguaccgaugc

 - 45

Get sequence
Deep sequencing111 reads, 69 experiments
Evidence experimental; SOLiD [5]
Predicted targets

Mature sequence rno-miR-101b-3p

Accession MIMAT0000615
Previous IDsrno-miR-101b
Sequence

61 - 

uacaguacugugauagcugaa

 - 81

Get sequence
Deep sequencing3359467 reads, 513 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).