Stem-loop sequence rno-mir-151

Accession MI0000647
Description Rattus norvegicus miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop 
--------------a   cu      c            ca          u uc 
               gcg  uuccug ccucgaggagcu  cagucuagua g  u
               |||  |||||| ||||||||||||  |||||||||| |  c
               ugc  agggac ggaguuccucgg  gucagaucau c  c
gcccuccacucauac   -u      a            -a          c cu
Get sequence
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. Landgraf et al show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
7: 110979296-110979392 [-]
sense
ENSRNOT00000011219 ; Ptk2; intron 21
ENSRNOT00000011219 ; Ptk2; intron 21
ENSRNOT00000011219 ; Ptk2; intron 21
ENSRNOT00000010896 ; D3ZA04_RAT; intron 22
ENSRNOT00000010896 ; D3ZA04_RAT; intron 22
ENSRNOT00000010896 ; D3ZA04_RAT; intron 22
ENSRNOT00000046362 ; D3ZUD6_RAT; intron 23
ENSRNOT00000046362 ; D3ZUD6_RAT; intron 23
ENSRNOT00000046362 ; D3ZUD6_RAT; intron 23
ENSRNOT00000065308 ; D3ZJ71_RAT; intron 24
ENSRNOT00000065308 ; D3ZJ71_RAT; intron 24
ENSRNOT00000065308 ; D3ZJ71_RAT; intron 24
Clustered miRNAs
< 10kb from rno-mir-151
rno-mir-3586 7: 110979296-110979415 [+]
rno-mir-151 7: 110979296-110979392 [-]
Database links
  • ENTREZGENE: 100314223;Mir151

Mature sequence rno-miR-151-5p

Accession MIMAT0000613
Previous IDs rno-miR-151*;rno-miR-151
Sequence

16 -  

ucgaggagcucacagucuagu

 - 36

Get sequence
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-151-3p

Accession MIMAT0000614
Previous IDs rno-miR-151;rno-miR-151*
Sequence

51 -  

cuagacugaggcuccuugagg

 - 71

Get sequence
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).