Stem-loop sequence mmu-mir-135b

AccessionMI0000646 (change log)
Symbol MGI:Mir135b
DescriptionMus musculus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

79 open access papers mention mmu-mir-135b
(450 sentences)

Stem-loop
   ------c     --                   cau          uug ug 
5'        gcucu  gcuguggccuauggcuuuu   uccuauguga   c  c
          |||||  |||||||||||||||||||   ||||||||||   |   
3'        cgggg  ugacaucggguaccgaaaa   gggauguacu   g  u
   ccucgaa     ag                   -uc          caa cc 
Get sequence
Deep sequencing
171011 reads, 1.64e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 132198088-132198184 [+]
sense
ENSMUST00000112357 ; Lemd1-201; intron 1
Database links

Mature sequence mmu-miR-135b-5p

Accession MIMAT0000612
Previous IDsmmu-miR-135b
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing170182 reads, 76 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-135b-3p

Accession MIMAT0017044
Previous IDsmmu-miR-135b*
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing819 reads, 38 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).