Stem-loop sequence mmu-mir-135b

Accession

MI0000646 (change log)

Symbol

MGI:Mir135b

Description

Mus musculus miR-135b stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

   ------c     --                   cau          uug ug 
5'        gcucu  gcuguggccuauggcuuuu   uccuauguga   c  c
          |||||  |||||||||||||||||||   ||||||||||   |   
3'        cgggg  ugacaucggguaccgaaaa   gggauguacu   g  u
   ccucgaa     ag                   -uc          caa cc 

Deep sequencing

157655 reads, 2.46e+03 reads per million, 51 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 132198088-132198184 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000112357 ; Lemd1-201; intron 1

Database links

• EntrezGene:Mir135b
• MGI:Mir135b
• RNAcentral:URS000075CCA1_10090
• miRBase Tracker:MI0000646

Mature sequence mmu-miR-135b-5p

• Accession: MIMAT0000612
• Previous IDs: mmu-miR-135b
• Sequence: 16 - uauggcuuuucauuccuauguga - 38
• Deep sequencing: 157116 reads, 51 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Database links:
  • RNAcentral:URS000001C659_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-135b-5p
  • miRDB:mmu-miR-135b-5p
  • microrna.org:mmu-miR-135b-5p

Mature sequence mmu-miR-135b-3p

• Accession: MIMAT0017044
• Previous IDs: mmu-miR-135b*
• Sequence: 55 - auguagggcuaaaagccauggg - 76
• Deep sequencing: 539 reads, 25 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS0000488C83_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-135b-3p
  • miRDB:mmu-miR-135b-3p

References

1. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).