Stem-loop sequence rno-mir-135b

AccessionMI0000645 (change log)
DescriptionRattus norvegicus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ------c     --                   cau          uug ug 
5'        gcucu  gcuguggccuauggcuuuu   uccuauguga   c  u
          |||||  |||||||||||||||||||   ||||||||||   |   
3'        cgggg  ugacaucggguaccgaaaa   gggauguacu   g  u
   ccucgaa     ag                   -uc          caa cc 
Get sequence
Deep sequencing
3940 reads, 25 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 48976986-48977082 [+]
intergenic
Database links

Mature sequence rno-miR-135b-5p

Accession MIMAT0000611
Previous IDsrno-miR-135b
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing3893 reads, 20 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-135b-3p

Accession MIMAT0017043
Previous IDsrno-miR-135b*
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing47 reads, 3 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).