Stem-loop sequence rno-mir-352

AccessionMI0000644 (change log)
DescriptionRattus norvegicus miR-352 stem-loop
Literature search

7 open access papers mention rno-mir-352
(83 sentences)

Stem-loop
   ------------------------------guacauauguugaag       aua     agu 
5'                                              auuauua   uauag   g
                                                |||||||   |||||    
3'                                              ugauggu   guguu   g
   aguaugugauguagcaugauacguuggaugaugagauguauagua       --g     gug 
Get sequence
Deep sequencing
1145 reads, 0 reads per million, 283 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. miR-352 is closely related to let-7d (a single deletion), but the predicted hairpin precursor sequences are unrelated, and express their mature forms from opposite strands.

Database links

Mature sequence rno-miR-352

Accession MIMAT0000610
Sequence

61 - 

agaguaguagguugcauagua

 - 81

Get sequence
Deep sequencing1144 reads, 298 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).