Stem-loop sequence mmu-mir-351

Accession MI0000643
Symbol MGI:Mir351
Description Mus musculus miR-351 stem-loop
Gene family MIPF0000244; mir-351
Stem-loop
----ca      ----     u     ug   a   c     g    gagugaa 
      uggcac    cuccg uuccc  agg gcc uuuga ccug       a
      ||||||    ||||| |||||  ||| ||| ||||| ||||        
      auugug    gaggu aaggg  ucc cgg gaacu ggac       a
cuucaa      agaa     c     --   g   a     -    aaaaaaa 
Get sequence
Deep sequencing
42560 reads, 97 experiments
Comments

The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [1].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 53053255-53053353 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-351
mmu-mir-322 chrX: 53054255-53054349 [-]
mmu-mir-503 chrX: 53053984-53054054 [-]
mmu-mir-351 chrX: 53053255-53053353 [-]
mmu-mir-542 chrX: 53049403-53049487 [-]
mmu-mir-450a-2 chrX: 53048299-53048367 [-]
mmu-mir-450a-1 chrX: 53048154-53048244 [-]
mmu-mir-450b chrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-351-5p

Accession MIMAT0000609
Previous IDs mmu-miR-351
Sequence

16 - 

ucccugaggagcccuuugagccug

 - 39

Get sequence
Deep sequencing 37343 reads, 81 experiments
Evidence experimental; cloned [1], Solexa [2,4]
Validated targets
Predicted targets

Mature sequence mmu-miR-351-3p

Accession MIMAT0017042
Previous IDs mmu-miR-351*
Sequence

58 - 

ggucaagaggcgccugggaac

 - 78

Get sequence
Deep sequencing 4409 reads, 73 experiments
Evidence experimental; 454 [3], Solexa [4]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).