|
miRBase |
|
Stem-loop sequence mmu-mir-351 |
|||||
| Accession | MI0000643 | ||||
| Symbol | MGI:Mir351 | ||||
| Description | Mus musculus miR-351 stem-loop | ||||
| Gene family | MIPF0000244; mir-351 | ||||
| Stem-loop |
----ca ---- u ug a c g gagugaa uggcac cuccg uuccc agg gcc uuuga ccug a |||||| ||||| ||||| ||| ||| ||||| |||| auugug gaggu aaggg ucc cgg gaacu ggac a cuucaa agaa c -- g a - aaaaaaa |
||||
| Deep sequencing |
| ||||
| Comments |
The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [1]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-351-5p |
|
| Accession | MIMAT0000609 |
| Previous IDs | mmu-miR-351 |
| Sequence |
16 - ucccugaggagcccuuugagccug - 39 |
| Deep sequencing | 37343 reads, 81 experiments |
| Evidence | experimental; cloned [1], Solexa [2,4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence mmu-miR-351-3p |
|
| Accession | MIMAT0017042 |
| Previous IDs | mmu-miR-351* |
| Sequence |
58 - ggucaagaggcgccugggaac - 78 |
| Deep sequencing | 4409 reads, 73 experiments |
| Evidence | experimental; 454 [3], Solexa [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|