Stem-loop sequence rno-mir-7a-1

AccessionMI0000641 (change log)
Previous IDsrno-mir-7;rno-mir-7-1
DescriptionRattus norvegicus miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ugu      a  u        a     a       u      --     a 
5'    uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    accgga ca gguauacc ucuga cacuaaa caacag  gaauc a
   ucc      -  c        g     -       -      ca     a 
Get sequence
Deep sequencing
2858 reads, 2.56 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. show that the 5' product is the predominant one [3]. The 3' product is renamed miR-7a*. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 6675016-6675112 [+]
sense
ENSRNOT00000025916 ; Hnrnpk-202; intron 14
ENSRNOT00000025980 ; Hnrnpk-201; intron 15
Database links

Mature sequence rno-miR-7a-5p

Accession MIMAT0000606
Previous IDsrno-miR-7;rno-miR-7a
Sequence

19 - 

uggaagacuagugauuuuguugu

 - 41

Get sequence
Deep sequencing4256 reads, 38 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-7a-1-3p

Accession MIMAT0000607
Previous IDsrno-miR-7*;rno-miR-7a*;rno-miR-7a-1*
Sequence

60 - 

acaacaaaucacagucugccau

 - 81

Get sequence
Deep sequencing723 reads, 36 experiments
Evidence experimental; cloned [1,3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).