Stem-loop sequence mmu-mir-350

AccessionMI0000640 (change log)
Symbol MGI:Mir350
DescriptionMus musculus miR-350 stem-loop
Gene family MIPF0000245; mir-350
Stem-loop
   agaugccuug      c   a  -      c   c      -     gugag 
5'           cuccua aag gu aaagug aug gcuuug ggaca     g
             |||||| ||| || |||||| ||| |||||| |||||     a
3'           gaggau uuc ca uuucac uac cgaaac cuugu     a
   -----guuga      -   c  c      a   c      a     aauaa 
Get sequence
Deep sequencing
31429 reads, 178 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000639) - its expression was later independently verified in mouse [2]. The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 176772325-176772423 [-]
sense
ENSMUST00000057037 ; Cep170-201; intron 8
Database links

Mature sequence mmu-miR-350-5p

Accession MIMAT0017040
Previous IDsmmu-miR-350*
Sequence

24 - 

aaagugcaugcgcuuuggg

 - 42

Get sequence
Deep sequencing2218 reads, 73 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-350-3p

Accession MIMAT0000605
Previous IDsmmu-miR-350
Sequence

61 - 

uucacaaagcccauacacuuuc

 - 82

Get sequence
Deep sequencing29206 reads, 76 experiments
Evidence experimental; cloned [2-3], Illumina [4,6]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).