Stem-loop sequence rno-mir-129-2

Accession MI0000637
Previous IDs rno-mir-129
Description Rattus norvegicus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
agacu             -       c   cu      ---     acau 
     gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
     ||||||||||||| ||||||| |||  ||||||   |||||     
     cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
-cgcg             c       c   uu      ggc     acuc 
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. Kim et al [1] and He et al [4] both identify the mature product from the 3' arm, named miR-129* here.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
3: 78648931-78649027 [-]
intergenic
Database links

Mature sequence rno-miR-129-5p

Accession MIMAT0000600
Previous IDs rno-miR-129
Sequence

19 - 

cuuuuugcggucugggcuugc

 - 39

Get sequence
Evidence experimental; cloned [2-3], SOLiD [5]

Mature sequence rno-miR-129-2-3p

Accession MIMAT0000601
Previous IDs rno-miR-129*;rno-miR-129-2*
Sequence

61 - 

aagcccuuaccccaaaaagcau

 - 82

Get sequence
Evidence experimental; cloned [1,3-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).