Stem-loop sequence rno-mir-129-2

AccessionMI0000637 (change log)
Previous IDsrno-mir-129
DescriptionRattus norvegicus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Literature search

27 open access papers mention rno-mir-129-2
(184 sentences)

Stem-loop
   agacu             -       c   cu      ---     acau 
5'      gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
        ||||||||||||| ||||||| |||  ||||||   |||||     
3'      cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
   -cgcg             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
330060 reads, 223 reads per million, 425 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. Kim et al [1] and He et al [4] both identify the mature product from the 3' arm, named miR-129* here.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 83137297-83137393 [-]
intergenic
Database links

Mature sequence rno-miR-129-5p

Accession MIMAT0000600
Previous IDsrno-miR-129
Sequence

19 - 

cuuuuugcggucugggcuugc

 - 39

Get sequence
Deep sequencing318388 reads, 399 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-129-2-3p

Accession MIMAT0000601
Previous IDsrno-miR-129*;rno-miR-129-2*
Sequence

61 - 

aagcccuuaccccaaaaagcau

 - 82

Get sequence
Deep sequencing170774 reads, 392 experiments
Evidence experimental; cloned [1,3-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).