Stem-loop sequence mmu-mir-346

AccessionMI0000634 (change log)
Symbol MGI:Mir346
DescriptionMus musculus miR-346 stem-loop
Gene family MIPF0000188; mir-346
Literature search

25 open access papers mention mmu-mir-346
(299 sentences)

Stem-loop
   -----------     g ug    u    cu    g   g        u  guug 
5'            ucugu u  ggcg cugu  gccc agu ccugccuc cu    c
              ||||| |  |||| ||||  |||| ||| |||||||| ||     
3'            agacg g  ccgu gacg  cggg ucg ggacggag ga    u
   cuuccucgucg     - gu    c    uc    -   g        -  aguc 
Get sequence
Deep sequencing
1223 reads, 12.2 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000633) - its expression has not been verified in mouse. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 34894609-34894706 [+]
sense
OTTMUST00000083227 ; Grid1-001; intron 2
ENSMUST00000043349 ; Grid1-001; intron 2
Database links

Mature sequence mmu-miR-346-5p

Accession MIMAT0000597
Previous IDsmmu-miR-346
Sequence

16 - 

ugucugcccgagugccugccucu

 - 38

Get sequence
Deep sequencing914 reads, 36 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-346-3p

Accession MIMAT0017039
Previous IDsmmu-miR-346*
Sequence

54 - 

aggcaggggcugggccugcagc

 - 75

Get sequence
Deep sequencing135 reads, 39 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).