|
miRBase |
|
Stem-loop sequence mmu-mir-346 |
|||||
| Accession | MI0000634 | ||||
| Symbol | MGI:Mir346 | ||||
| Description | Mus musculus miR-346 stem-loop | ||||
| Gene family | MIPF0000188; mir-346 | ||||
| Stem-loop |
----------- g ug u cu g g u guug ucugu u ggcg cugu gccc agu ccugccuc cu c ||||| | |||| |||| |||| ||| |||||||| || agacg g ccgu gacg cggg ucg ggacggag ga u cuuccucgucg - gu c uc - g - aguc |
||||
| Deep sequencing |
| ||||
| Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000633 ) - its expression has not been verified in mouse. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-346-5p |
|
| Accession | MIMAT0000597 |
| Previous IDs | mmu-miR-346 |
| Sequence |
16 - ugucugcccgagugccugccucu - 38 |
| Deep sequencing | 864 reads, 28 experiments |
| Evidence | experimental; Solexa [2-3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence mmu-miR-346-3p |
|
| Accession | MIMAT0017039 |
| Previous IDs | mmu-miR-346* |
| Sequence |
54 - aggcaggggcugggccugcagc - 75 |
| Deep sequencing | 18 reads, 11 experiments |
| Evidence | experimental; Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|