Stem-loop sequence mmu-mir-345

AccessionMI0000632 (change log)
Symbol MGI:Mir345
DescriptionMus musculus miR-345 stem-loop
Gene family MIPF0000189; mir-345
Stem-loop
   --------acc   gu     c  g u          c   u    -      
5'            caa  ccagg cu c gaccccuagu cag gcuu guggu 
              |||  ||||| || | |||||||||| ||| |||| |||| g
3'            guu  ggucc ga g cuggggauca guc cggg caucg 
   ggacaccucua   ug     a  g u          a   c    u      
Get sequence
Deep sequencing
122506 reads, 624 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA was predicted based on homology to the verified rat sequence (MI0000631). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later verified mature miRNA expression from both arms of the hairpin precursor [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 108836973-108837068 [+]
intergenic
Database links

Mature sequence mmu-miR-345-5p

Accession MIMAT0000595
Previous IDsmmu-miR-345
Sequence

17 - 

gcugaccccuaguccagugcuu

 - 38

Get sequence
Deep sequencing54147 reads, 74 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-345-3p

Accession MIMAT0004656
Sequence

55 - 

ccugaacuaggggucuggagac

 - 76

Get sequence
Deep sequencing68320 reads, 74 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).