Stem-loop sequence rno-mir-345

AccessionMI0000631 (change log)
DescriptionRattus norvegicus miR-345 stem-loop
Gene family MIPF0000189; mir-345
Stem-loop
   --------acc   gu     c  g u          c   u    -      
5'            caa  ccagg cu c gaccccuagu cag gcuu guggu 
              |||  ||||| || | |||||||||| ||| |||| |||| g
3'            guu  ggucc ga g cuggggauca guc cggg caucg 
   ggacaccucua   ug     a  g u          a   c    u      
Get sequence
Deep sequencing
3150 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 132748968-132749063 [+]
intergenic
Database links

Mature sequence rno-miR-345-5p

Accession MIMAT0000594
Previous IDsrno-miR-345
Sequence

16 - 

ugcugaccccuaguccagugc

 - 36

Get sequence
Deep sequencing1513 reads, 39 experiments
Evidence experimental; cloned [1-3], Northern [1], SOLiD [5]
Predicted targets

Mature sequence rno-miR-345-3p

Accession MIMAT0004655
Sequence

54 - 

cccugaacuaggggucuggaga

 - 75

Get sequence
Deep sequencing1636 reads, 38 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).