Stem-loop sequence mmu-mir-344-1

AccessionMI0000630 (change log)
Previous IDsmmu-mir-344
Symbol MGI:Mir344
DescriptionMus musculus miR-344-1 stem-loop
Gene family MIPF0000267; mir-344
Stem-loop
   cugcagc        uuac          cc         uc        a 
5'        caggguuu    cagucaggcu  uggcuagau  cagguacc g
          ||||||||    ||||||||||  |||||||||  ||||||||  
3'        gucccgaa    gucaguccga  accgaucua  guccaugg c
   ---acaa        ---u          -a         --        u 
Get sequence
Deep sequencing
9917 reads, 126 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000629) - its expression was later independently verified in mouse [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61877770-61877864 [-]
intergenic
Database links

Mature sequence mmu-miR-344-5p

Accession MIMAT0017038
Previous IDsmmu-miR-344*
Sequence

21 - 

agucaggcuccuggcuagauuccagg

 - 46

Get sequence
Deep sequencing108 reads, 12 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-344-3p

Accession MIMAT0000593
Previous IDsmmu-miR-344
Sequence

61 - 

ugaucuagccaaagccugacugu

 - 83

Get sequence
Deep sequencing19726 reads, 35 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).