Stem-loop sequence rno-mir-343

AccessionMI0000628 (change log)
DescriptionRattus norvegicus miR-343 stem-loop
Gene family MIPF0000411; mir-343
Literature search

4 open access papers mention rno-mir-343
(4 sentences)

Stem-loop
   gcaccuucauggacc   --a    - -g    ug  g         c   --     
5'                ugg   guag a  uggg  ug cggggggag agg  gccc 
                  |||   |||| |  ||||  || ||||||||| |||  ||| a
3'                acc   cguc u  accc  gu gccucccuc ucc  cggg 
   --------------a   gua    c ag    gu  -         -   aa     
Get sequence
Deep sequencing
10 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal UU sequence, which conflicts with the precursor sequence shown here.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 80298686-80298778 [+]
sense
ENSRNOT00000024246 ; Ercc2-201; 3'UTR (exon 8)
Database links

Mature sequence rno-miR-343

Accession MIMAT0000591
Sequence

61 - 

ucucccuccgugugcccaga

 - 80

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).