Stem-loop sequence mmu-mir-342

Accession MI0000627
Symbol MGI:Mir342
Description Mus musculus miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop 
gaaaau    u        g      --ua      auuga      ugg  a 
      gggc caagguga gggugc    ucugug     gggaca   uc a
      |||| |||||||| ||||||    ||||||     ||||||   ||  
      uccg guuccacu cccacg    agacac     cucugu   ag u
-agucg    -        g      cuaa      ----a      -ua  g
Get sequence
Deep sequencing
201624 reads, 97 experiments
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000626 ). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 108658620-108658718 [+]
sense
ENSMUST00000109854 ; Evl-203; intron 3
ENSMUST00000077735 ; Evl-202; intron 3
ENSMUST00000021689 ; Evl-201; intron 3
ENSMUST00000172409 ; Evl-204; intron 4
Database links

Mature sequence mmu-miR-342-5p

Accession MIMAT0004653
Sequence

19 -  

aggggugcuaucugugauugag

 - 40

Get sequence
Deep sequencing 20426 reads, 79 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-342-3p

Accession MIMAT0000590
Previous IDs mmu-miR-342
Sequence

61 -  

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing 129620 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).