Stem-loop sequence rno-mir-342

AccessionMI0000626 (change log)
DescriptionRattus norvegicus miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
   gaaaau    u        g      --ua      auuga      ugg  a 
5'       gggc caagguga gggugc    ucugug     gggaca   uc a
         |||| |||||||| ||||||    ||||||     ||||||   ||  
3'       uccg guuccacu cccacg    agacac     cucugu   ag u
   -agucg    -        g      cuaa      ----a      -ua  g 
Get sequence
Deep sequencing
6155 reads, 20.5 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 132561169-132561267 [+]
sense
ENSRNOT00000019583 ; Evl-201; intron 2
Database links

Mature sequence rno-miR-342-5p

Accession MIMAT0004652
Sequence

19 - 

aggggugcuaucugugauugag

 - 40

Get sequence
Deep sequencing351 reads, 32 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-342-3p

Accession MIMAT0000589
Previous IDsrno-miR-342
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing5786 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).