Stem-loop sequence mmu-mir-341

AccessionMI0000625 (change log)
Symbol MGI:Mir341
DescriptionMus musculus miR-341 stem-loop
Gene family MIPF0000269; mir-341
Stem-loop
   aaaau   --  u   ag       gu          cu   u   u a 
5'      gau  ga guc  uuggccg  cggccgaucg  cgg cug c g
        |||  || |||  |||||||  ||||||||||  ||| ||| | u
3'      cug  cu cgg  gacuggc  gcuggcuagc  gcu ggc g c
   --cuu   uc  u   cu       ug          ug   -   u a 
Get sequence
Deep sequencing
28586 reads, 131 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000624) - its expression was later verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109611500-109611595 [+]
sense
OTTMUST00000113328 ; Rian-010; intron 2
OTTMUST00000113329 ; Rian-012; intron 2
ENSMUST00000183215 ; Rian-010; intron 2
ENSMUST00000182689 ; Rian-012; intron 2
Clustered miRNAs
< 10kb from mmu-mir-341
mmu-mir-341chr12: 109611500-109611595 [+]
mmu-mir-1188chr12: 109611822-109611941 [+]
mmu-mir-370chr12: 109618258-109618336 [+]
Database links

Mature sequence mmu-miR-341-5p

Accession MIMAT0017037
Previous IDsmmu-miR-341*
Sequence

22 - 

cggucggccgaucgcucgguc

 - 42

Get sequence
Deep sequencing110 reads, 15 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-341-3p

Accession MIMAT0000588
Previous IDsmmu-miR-341
Sequence

57 - 

ucggucgaucggucggucggu

 - 77

Get sequence
Deep sequencing28448 reads, 65 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).