Stem-loop sequence mmu-mir-340

AccessionMI0000623 (change log)
Symbol MGI:Mir340
DescriptionMus musculus miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
   caauu     u      au       -caa      u    g     ug 
5'      guacu ggugug  uauaaag    ugagac gauu ucaua  u
        ||||| ||||||  |||||||    |||||| |||| |||||  c
3'      uaugg ccauac  auauuuc    acucug cuag ggugu  g
   -auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
323427 reads, 1.76e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 50069702-50069799 [+]
sense
OTTMUST00000012382 ; Rnf130-002; intron 2
OTTMUST00000012381 ; Rnf130-001; intron 2
ENSMUST00000054684 ; Rnf130-002; intron 2
ENSMUST00000102776 ; Rnf130-001; intron 2
Database links

Mature sequence mmu-miR-340-5p

Accession MIMAT0004651
Sequence

19 - 

uuauaaagcaaugagacugauu

 - 40

Get sequence
Deep sequencing321938 reads, 76 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-340-3p

Accession MIMAT0000586
Previous IDsmmu-miR-340
Sequence

61 - 

uccgucucaguuacuuuauagc

 - 82

Get sequence
Deep sequencing1303 reads, 60 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).