Stem-loop sequence rno-mir-340-1

AccessionMI0000622 (change log)
Previous IDsrno-mir-340
DescriptionRattus norvegicus miR-340-1 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
   cacuu     c      au       -caa      u    g     ug 
5'      guacu ggugug  uauaaag    ugagac gauu ucaug  u
        ||||| ||||||  |||||||    |||||| |||| |||||  c
3'      uaugg ccauac  auauuuc    acucug cuag ggugu  g
   -auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
24211 reads, 159 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 35558983-35559080 [+]
sense
ENSRNOT00000071917 ; Rnf130-201; intron 1
Database links

Mature sequence rno-miR-340-5p

Accession MIMAT0004650
Sequence

19 - 

uuauaaagcaaugagacugauu

 - 40

Get sequence
Deep sequencing46012 reads, 39 experiments
Evidence experimental; cloned [2]

Mature sequence rno-miR-340-3p

Accession MIMAT0000585
Previous IDsrno-miR-340
Sequence

61 - 

uccgucucaguuacuuuauagcc

 - 83

Get sequence
Deep sequencing2408 reads, 38 experiments
Evidence experimental; cloned [1]

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).