Stem-loop sequence mmu-mir-339

AccessionMI0000621 (change log)
Symbol MGI:Mir339
DescriptionMus musculus miR-339 stem-loop
Gene family MIPF0000193; mir-339
Stem-loop
   ----------ac       c    au c     cu  -   a      --   u 
5'             ggggugg cacu  c cuguc  cc agg gcucac  gua g
               ||||||| ||||  | |||||  || ||| ||||||  |||  
3'             ccccacc gugg  g gacag  gg ucc cgagug  cgu c
   caccugucacgu       u    cc a     -c  c   g      uc   c 
Get sequence
Deep sequencing
16621 reads, 78.9 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 139369650-139369745 [-]
sense
OTTMUST00000091859 ; RP23-205J6.1-001; intron 2
ENSMUST00000066052 ; 3110082I17Rik-001; intron 2
Database links

Mature sequence mmu-miR-339-5p

Accession MIMAT0000584
Previous IDsmmu-miR-339
Sequence

16 - 

ucccuguccuccaggagcucacg

 - 38

Get sequence
Deep sequencing13785 reads, 76 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-339-3p

Accession MIMAT0004649
Sequence

51 - 

ugagcgccucggcgacagagccg

 - 73

Get sequence
Deep sequencing2836 reads, 75 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).