Stem-loop sequence mmu-mir-338

AccessionMI0000619 (change log)
Symbol MGI:Mir338
DescriptionMus musculus miR-338 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   caacgcugcaca   c      cc      u   -         -   g g g 
5'             ggc guccuc  caacaa auc cuggugcug agu g u c
               ||| ||||||  |||||| ||| ||||||||| ||| | |  
3'             ucg cgggag  guuguu uag gacuacgac uca u a a
   --------accg   a      aa      u   u         c   g g c 
Get sequence
Deep sequencing
21932 reads, 158 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 120014765-120014862 [-]
sense
OTTMUST00000009044 ; Aatk-008; intron 3
OTTMUST00000009043 ; Aatk-007; intron 4
OTTMUST00000009037 ; Aatk-001; intron 7
OTTMUST00000009038 ; Aatk-002; intron 7
OTTMUST00000009039 ; Aatk-003; intron 7
OTTMUST00000009040 ; Aatk-004; intron 7
ENSMUST00000136386 ; Aatk-008; intron 3
ENSMUST00000132575 ; Aatk-007; intron 4
ENSMUST00000064307 ; Aatk-002; intron 7
ENSMUST00000150730 ; Aatk-004; intron 7
ENSMUST00000103020 ; Aatk-001; intron 7
ENSMUST00000103019 ; Aatk-003; intron 7
Clustered miRNAs
< 10kb from mmu-mir-338
mmu-mir-3065chr11: 120014767-120014853 [+]
mmu-mir-338chr11: 120014765-120014862 [-]
Database links

Mature sequence mmu-miR-338-5p

Accession MIMAT0004647
Sequence

26 - 

aacaauauccuggugcugagug

 - 47

Get sequence
Deep sequencing3757 reads, 48 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-338-3p

Accession MIMAT0000582
Previous IDsmmu-miR-338
Sequence

61 - 

uccagcaucagugauuuuguug

 - 82

Get sequence
Deep sequencing18172 reads, 55 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).