Stem-loop sequence rno-mir-338

AccessionMI0000618 (change log)
DescriptionRattus norvegicus miR-338 stem-loop
Gene family MIPF0000097; mir-338
Literature search

17 open access papers mention rno-mir-338
(141 sentences)

Stem-loop
   uccc      u   -         -   g g g 
5'     caacaa auc cuggugcug agu g u c
       |||||| ||| ||||||||| ||| | |  
3'     guuguu uag gacuacgac uca u a a
   agaa      u   u         c   g g c 
Get sequence
Deep sequencing
989421 reads, 770 reads per million, 485 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 109195251-109195316 [-]
sense
ENSRNOT00000005839 ; Aatk-201; intron 7
antisense
ENSRNOT00000053588 ; Mir3065-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-338
rno-mir-338chr10: 109195251-109195316 [-]
rno-mir-3065chr10: 109195234-109195336 [+]
Database links

Mature sequence rno-miR-338-5p

Accession MIMAT0004646
Previous IDsrno-miR-338*
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Deep sequencing74861 reads, 441 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-338-3p

Accession MIMAT0000581
Previous IDsrno-miR-338
Sequence

41 - 

uccagcaucagugauuuuguuga

 - 63

Get sequence
Deep sequencing914558 reads, 483 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).