Stem-loop sequence rno-mir-338

AccessionMI0000618 (change log)
DescriptionRattus norvegicus miR-338 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uccc      u   -         -   g g g 
5'     caacaa auc cuggugcug agu g u c
       |||||| ||| ||||||||| ||| | |  
3'     guuguu uag gacuacgac uca u a a
   agaa      u   u         c   g g c 
Get sequence
Deep sequencing
109954 reads, 908 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 109195251-109195316 [-]
sense
ENSRNOT00000005839 ; Aatk-201; intron 7
antisense
ENSRNOT00000053588 ; Mir3065-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-338
rno-mir-338chr10: 109195251-109195316 [-]
rno-mir-3065chr10: 109195234-109195336 [+]
Database links

Mature sequence rno-miR-338-5p

Accession MIMAT0004646
Previous IDsrno-miR-338*
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Deep sequencing7327 reads, 33 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-338-3p

Accession MIMAT0000581
Previous IDsrno-miR-338
Sequence

41 - 

uccagcaucagugauuuuguuga

 - 63

Get sequence
Deep sequencing102627 reads, 38 experiments
Evidence experimental; cloned [1-4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).