Stem-loop sequence mmu-mir-148b

AccessionMI0000617 (change log)
Symbol MGI:Mir148b
DescriptionMus musculus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Literature search

46 open access papers mention mmu-mir-148b
(331 sentences)

Stem-loop
   caggcacccuu   a       ug         u  a   ------    -  u 
5'            agc uuugagg  aaguucugu au cac      ucag gc g
              ||| |||||||  ||||||||| || |||      |||| ||  
3'            ucg aagcucu  uucaagaca ua gug      aguc cg u
   ------aucuu   a       gu         c  c   acugaa    u  g 
Get sequence
Deep sequencing
799694 reads, 2.32e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 103285125-103285221 [+]
sense
ENSMUST00000100162 ; Copz1-201; intron 1
Database links

Mature sequence mmu-miR-148b-5p

Accession MIMAT0017036
Previous IDsmmu-miR-148b*
Sequence

24 - 

gaaguucuguuauacacucaggcu

 - 47

Get sequence
Deep sequencing10699 reads, 101 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-148b-3p

Accession MIMAT0000580
Previous IDsmmu-miR-148b
Sequence

61 - 

ucagugcaucacagaacuuugu

 - 82

Get sequence
Deep sequencing788989 reads, 107 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).