Stem-loop sequence mmu-mir-148b

Accession

MI0000617

Symbol

MGI:Mir148b

Description

Mus musculus miR-148b stem-loop

Gene family

MIPF0000056; mir-148

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

caggcacccuu   a       ug         u  a   ------    -  u 
           agc uuugagg  aaguucugu au cac      ucag gc g
           ||| |||||||  ||||||||| || |||      |||| ||  
           ucg aagcucu  uucaagaca ua gug      aguc cg u
------aucuu   a       gu         c  c   acugaa    u  g 

Deep sequencing

777322 reads, 97 experiments

Genome context

• Coordinates (GRCm38): chr15: 103285125-103285221 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000100162 ; Copz1-201; intron 1

Database links

• ENTREZGENE: 724064;Mir148b
• MGI: 3618734;Mir148b

Mature sequence mmu-miR-148b-5p

• Accession: MIMAT0017036
• Previous IDs: mmu-miR-148b*
• Sequence: 24 - gaaguucuguuauacacucaggcu - 47
• Deep sequencing: 3368 reads, 78 experiments
• Evidence: experimental; Solexa [3]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-148b-5p
  • MIRDB:mmu-miR-148b-5p
  • RNA22-MMU:mmu-miR-148b-5p

Mature sequence mmu-miR-148b-3p

• Accession: MIMAT0000580
• Previous IDs: mmu-miR-148b
• Sequence: 61 - ucagugcaucacagaacuuugu - 82
• Deep sequencing: 595003 reads, 82 experiments
• Evidence: experimental; cloned [1], Solexa [2-3]
• Validated targets:
  • TARBASE:mmu-miR-148b-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-148b-3p
  • MICRORNA.ORG:mmu-miR-148b-3p
  • MIRDB:mmu-miR-148b-3p
  • RNA22-MMU:mmu-miR-148b-3p
  • TARGETSCAN-VERT:mmu-miR-148b

References

1. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).