Stem-loop sequence rno-mir-148b

Accession MI0000616
Description Rattus norvegicus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
caggcacucuu   a       ug         u  a   ------    -  u 
           agc uuugagg  aaguucugu au cac      ucag gc g
           ||| |||||||  ||||||||| || |||      |||| ||  
           ucg aagcucu  uucaagaca ua gug      aguc cg u
------aucuu   a       gu         c  c   acugaa    u  g 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
7: 142195694-142195790 [+]
sense
ENSRNOT00000065270 ; Copz1; intron 1
ENSRNOT00000065270 ; Copz1; intron 1
ENSRNOT00000065270 ; Copz1; intron 1
Database links

Mature sequence rno-miR-148b-5p

Accession MIMAT0004645
Sequence

24 - 

gaaguucuguuauacacucagg

 - 45

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-148b-3p

Accession MIMAT0000579
Previous IDs rno-miR-148b
Sequence

61 - 

ucagugcaucacagaacuuugu

 - 82

Get sequence
Evidence experimental; cloned [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).