Stem-loop sequence rno-mir-337

AccessionMI0000614 (change log)
DescriptionRattus norvegicus miR-337 stem-loop
Gene family MIPF0000195; mir-337
Literature search

5 open access papers mention rno-mir-337
(5 sentences)

Stem-loop
   aguguagugagaa uu         -   c         c         u  ca 
5'              g  ggggggugg gaa ggcgucaug aggaguuga ug  c
                |  ||||||||| ||| ||||||||| ||||||||| ||   
3'              c  ucccccacu cuu ccguaguau uccucgacu ac  a
   -----------aa -u         u   u         a         u  cg 
Get sequence
Deep sequencing
45587 reads, 21.3 reads per million, 357 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133705920-133706016 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-337
rno-mir-493chr6: 133699509-133699592 [+]
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
Database links

Mature sequence rno-miR-337-5p

Accession MIMAT0017035
Previous IDsrno-miR-337*
Sequence

29 - 

cggcgucaugcaggaguugau

 - 49

Get sequence
Deep sequencing39331 reads, 351 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-337-3p

Accession MIMAT0000577
Previous IDsrno-miR-337
Sequence

60 - 

uucagcuccuauaugaugccuuu

 - 82

Get sequence
Deep sequencing6254 reads, 238 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).