Stem-loop sequence rno-mir-140

Accession MI0000611
Description Rattus norvegicus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
-   u    cucu        -  a             a       uu   uc 
 gug cucu    guguccug cc gugguuuuacccu ugguagg  aca  a
 ||| ||||    |||||||| || ||||||||||||| |||||||  |||   
 cac gagg    cauaggac gg caccaagauggga accaucu  ugu  u
c   -    ---u        a  -             c       --   cg 
Get sequence
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The cloned miRNA appears to be expressed from the 3' strand of the precursor, and is therefore named miR-140* here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
19: 37422704-37422802 [+]
sense
ENSRNOT00000018837 ; Wwp2; intron 16
ENSRNOT00000018837 ; Wwp2; intron 16
ENSRNOT00000018837 ; Wwp2; intron 16
Database links

Mature sequence rno-miR-140-5p

Accession MIMAT0000573
Previous IDs rno-miR-140
Sequence

22 - 

cagugguuuuacccuaugguag

 - 43

Get sequence
Evidence experimental; cloned [3-4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-140-3p

Accession MIMAT0000574
Previous IDs rno-miR-140*
Sequence

61 - 

uaccacaggguagaaccacgg

 - 81

Get sequence
Evidence experimental; cloned [1-2,4], Northern [1], SOLiD [5]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).