Stem-loop sequence mmu-mir-331

AccessionMI0000609 (change log)
Symbol MGI:Mir331
DescriptionMus musculus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   gagucu  uuuu         u        u    u       au ccaga 
5'       gg    guuuggguu guucuagg augg cccaggg  c     u
         ||    ||||||||| |||||||| |||| |||||||  |     c
3'       cc    caaauccaa caagaucc uauc ggguccc  g     a
   ----ug  ----         c        -    c       cg accaa 
Get sequence
Deep sequencing
28177 reads, 124 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 93963768-93963863 [-]
sense
OTTMUST00000076728 ; Vezt-011; intron 2
OTTMUST00000076692 ; Vezt-001; 3'UTR (exon 12)
ENSMUST00000148450 ; Vezt-011; intron 2
ENSMUST00000119818 ; Vezt-001; 3'UTR (exon 12)
Database links

Mature sequence mmu-miR-331-5p

Accession MIMAT0004643
Sequence

26 - 

cuagguauggucccagggaucc

 - 47

Get sequence
Deep sequencing541 reads, 65 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-331-3p

Accession MIMAT0000571
Previous IDsmmu-miR-331
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing27428 reads, 75 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).