Stem-loop sequence rno-mir-331

AccessionMI0000608 (change log)
DescriptionRattus norvegicus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

7 open access papers mention rno-mir-331
(17 sentences)

Stem-loop
   gaguc   ucuu         u        u    u       au ccaga 
5'      ugg    guuuggguu guucuagg augg cccaggg  c     u
        |||    ||||||||| |||||||| |||| |||||||  |     c
3'      acc    caaauccaa caagaucc uauc ggguccc  g     a
   ----u   ----         c        -    c       cg accaa 
Get sequence
Deep sequencing
75313 reads, 11.7 reads per million, 488 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MI0000609).

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 34881095-34881190 [-]
intergenic
Database links

Mature sequence rno-miR-331-5p

Accession MIMAT0017033
Previous IDsrno-miR-331*
Sequence

7 - 

ggucuuguuuggguuuguu

 - 25

Get sequence
Deep sequencing462 reads, 215 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-331-3p

Accession MIMAT0000570
Previous IDsrno-miR-331
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing72424 reads, 484 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).